Cartilage-Specific Cre Recombinase Transgenes/Alleles in the Mouse

Cartilage is a specialized skeletal tissue with a unique extracellular matrix elaborated by its resident cells, chondrocytes. The tissue presents in several forms, including growth plate and articular cartilage, wherein chondrocytes follow a differential

  • PDF / 620,702 Bytes
  • 16 Pages / 504.567 x 720 pts Page_size
  • 81 Downloads / 257 Views

DOWNLOAD

REPORT


1

The Cre-loxP and Tet-ON/Tet-OFF Technologies In vivo studies on gene functions and regulation and on the effects of specific mutations found in human diseases are often carried out using genetically modified mice. For this purpose, genes can be globally knocked out (inactivated) or knocked in (insertion of a desired mutation) using homologous recombination into mouse embryonic stem (ES) cells or fertilized oocytes. These gene alterations, however, can be early lethal or result in complex, multi-tissue phenotypes. To overcome such problems, conditional knockout (CKO)/knockin (CKI) technologies have been utilized. A main strategy consists in generating mice carrying

Tariq M. Haqqi and Ve´ronique Lefebvre (eds.), Chondrocytes: Methods and Protocols, Methods in Molecular Biology, vol. 2245, https://doi.org/10.1007/978-1-0716-1119-7_3, © Springer Science+Business Media, LLC, part of Springer Nature 2021

23

24

Ioannis Kanakis et al.

both a tissue-specific Cre transgene and a floxed gene, such that the gene of interest is recombined only in cells that express Cre (Fig. 1). Cre is a 38-kDa tyrosine recombinase produced from the Cre (cyclization recombinase) gene of the bacteriophage P1 [1, 2]. It recognizes loxP (locus of X-over P1) sequences, that are palindromes of two 13-bp sequences flanking an 8-bp core (5' ATAACTTCGTATAATGTATGCTATACGAAGTTAT 3'; 34 bp in total). When two loxP sites are inserted in the same orientation, Cre recombines them into a single site and concomitantly deletes the intervening sequence (also known as loxP-flanked or floxed sequence) [3, 4]. When the two loxP sites are in opposite orientation, Cre induces inversion of the intervening sequence [5, 6]. Even CKO/CKI strategies can be early lethal or cause complex phenotypes. For example, the cartilage-specific Col2a1 gene starts to be expressed in mid-gestation mouse embryos (E9.5, or E9.5) [7]. Therefore, Cre transgenes driven by Col2a1 regulatory elements recombine floxed genes from this stage onwards. Thus, if genes are critical in early life, this strategy is not suitable to study

Fig. 1 Illustration of transgenic mouse generation using the conditional Cre-loxP gene manipulation. One transgenic mouse has a cell-specific regulatory sequence-driven Cre gene and the second transgenic mouse harbors a loxP-flanked (floxed) allele of the gene of interest. Expression of Cre recombinase results in recombination of the LoxP sites and thereby in inactivation (or other targeted modification) of the gene of interest

Cartilage-Specific Cre Recombinase Transgenes/Alleles in the Mouse

25

gene functions in adulthood. To circumvent this issue, inducible conditional systems (iCKO/iCKI) have been developed that permit modifying genes at a desired time. The two main inducible strategies use Cre-ERT [3, 5, 8] and the Tet-ON/Tet-OFF system [6, 9, 10]. Cre-ERT consists of a fusion of Cre with a mutated form of the ligand-binding domain of the estrogen receptor (ER). This mutant domain (ERT) binds tamoxifen, but not endogenous estrogen [11, 12]. Cre-ERT is