Bufo MHC class II loci with conserved introns flanking exon 2: cross-species amplification with common primers
- PDF / 215,554 Bytes
- 3 Pages / 595.276 x 790.866 pts Page_size
- 38 Downloads / 215 Views
TECHNICAL NOTE
Bufo MHC class II loci with conserved introns flanking exon 2: cross-species amplification with common primers Inga Zeisset • Trevor J. C. Beebee
Received: 23 July 2012 / Accepted: 29 August 2012 / Published online: 14 September 2012 Ó Springer Science+Business Media B.V. 2012
Abstract We characterized the complete second exon with adjacent introns of MHC class II beta genes in the anurans Bufo calamita, B. bufo and B. viridis. Introns were remarkably conserved among species. There were at least two loci (A and B), which we amplified with different forward primers but identical reverse primers. Locus A had low diversity whereas locus B exhibited 42 alleles in B. calamita and 14 in B. bufo. We detected evidence of positive selection at antigen binding sites in both these species and demonstrated expression of locus B in B. calamita. Keywords MHC Beta chain Bufo calamita Bufo bufo Bufo viridis
Amphibians are experiencing severe global declines (Stuart et al. 2004), partly due to emerging infectious diseases such as the fungus Batrachochytrium dendrobatidis. MHC class II molecules play an important role in mounting the acquired immune responses to fungi and contribute to fighting such infections (Richmond et al. 2009). To investigate the protective role of MHC genes in amphibians, molecular markers are needed for MHC loci in a wide range of species. We isolated and sequenced the entire second exon and flanking regions in introns 1 and 2 of two MHC class II loci in three toad species. We used a vectorette approach adapted from Ko et al. (2003) and Babik et al. (2008) to obtain adjacent intron sequences for exon 2 of partially characterized MHC loci I. Zeisset (&) T. J. C. Beebee School of Life Sciences, University of Sussex, Falmer, Brighton BN1 9QG, UK e-mail: [email protected]
in B. calamita (May and Beebee 2009). We identified at least two loci (A and B) that differed in their intron 1 sequence, but not at intron 2. Population genetic data indicate that locus A actually consists of two loci with partially identical flanking introns (data not shown). We sequenced up to 227 base pairs of adjacent intron 2 sequence in four B. calamita individuals with different alleles (B2, B6, A1 and A3) and identified a repeat of 100–102 base pairs, reiterated at least 3 times and differing only in a few bases between alleles (Genbank nos: JX258914–JX258917). Of intron 1 we obtained about 200 bp of sequence for locus B and 300 bp for locus A (Genbank nos: JX258913, JX258918). Because of the intron 2 repeat sequence the primers amplified several PCR products differing about 100 bp in size. Based on the intron sequences we developed two forward and one reverse primer to amplify the two loci: For locus B forward primer 2F347 (GTGACCCTCTGCTCTC CATT) to amplify a sequence of 282 bp and for locus A primer 3F279 (GGCGGTCTTAACACACATGA) to amplify 292 bp. The reverse primer for both was 2R307b (ATAATTCAGTATATACAGGGTCTCACC). These primers were also used to characterize orthologous MHC loci in the common toad B.
Data Loading...