Expression and Purification of Active Protein Kinases from Wheat Germ Extracts

In vitro functional studies of eukaryotic kinases are often constrained by the availability of pure and ­enzymatically active kinase of interest. Though numerous proteins have been synthesized by cell-based systems, in vivo production of properly folded,

  • PDF / 138,642 Bytes
  • 9 Pages / 504.567 x 720 pts Page_size
  • 22 Downloads / 279 Views

DOWNLOAD

REPORT


oduction Escherichia coli-based protein overexpression systems are the ­traditional method of choice for targeted protein synthesis; however, application of these systems is severely limited by the fact that ­multidomain eukaryotic proteins tend to form aggregates in prokaryotic cells. Various alterations have been made to the E. coli system to alleviate this inherent limitation, but there are no general methods for successful protein production in prokaryotic cells, which makes the procedure laborious (1). The eukaryotic cell-based expression systems offer advantage over the bacterial systems in terms of protein

N. Dissmeyer and A. Schnittger (eds.), Plant Kinases: Methods and Protocols, Methods in Molecular Biology, vol. 779, DOI 10.1007/978-1-61779-264-9_3, © Springer Science+Business Media, LLC 2011

55

56

B. Sonkoly et al.

folding and posttranslational modifying capacity, but often require laboratories with dedicated instrumentation and are not suitable for parallel production of a panel of proteins. The robustness of the translation apparatus is known since the 1950s, but only the latest technical improvements made the ­cell-free translation a reasonable alternative of cell-based protein synthesis (2). Various sources of translation machinery could be used in cell-free in  vitro translation systems, but – due to the prokaryotic nature of protein translation and folding – E. coli extract is not optimal for the production of eukaryotic proteins. Cell-free systems originated from reticulocytes, yeast, and insect cells provide eukaryotic proteins in their native folded form but all suffer from low productivity. Presently, wheat-germ-derived extract seems the most promising choice for preparative protein in vitro translation for these systems cost-effectively synthesize properly folded eukaryotic proteins at mg/ml scale (3).

2. Materials 2.1. Cloning and Purification of In Vitro Translation Vectors

1. High-fidelity DNA polymerase. 2. PCR cleaning-up buffer: 26.2% (w/v) PEG 8000, 6.6  mM MgCl2, 0.6 M NaOAc, pH 5.2 (4). 3. SspI restriction endonuclease, T4 DNA polymerase, 10  mM dNTP mix, and 100 mM dCTP and dGTP stock solutions. 4. TAE buffer: 40 mM Tris–acetate, 1 mM EDTA, pH 8.0. 5. 5 mM EDTA. 6. 0.8% (w/v) agarose gel in TAE buffer. 7. Agarose gel staining solution: 2× GelGreen (Biotium) in H2O with 100 mM NaCl. 8. Commercial agarose gel extraction kit. 9. SOC medium: 0.5% (w/v) yeast extract, 2% (w/v) tryptone, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, 20 mM glucose. 10. Standard competent cells. 11. LB agar plates containing 100 mg/ml carbenicillin. 12. PureYield Plasmid Miniprep System (Promega). 13. RNase-free water, barrier tips. 14. pEU vector specific primers: pEUE01 forward: CGATTTA GGTGACACTATAGAACTC pEU3-NII forward: CACTATAGGGTACACGGAATTCGC pEU reverse: TATAGGAAGGCCGGATAAGACG. 15. FastDigest NotI (Fermentas).

3  Expression and Purification of Active Protein Kinases from Wheat Germ Extracts

2.2. In Vitro Translation and Purification of Proteins

57

1. Wheat germ in vitro protein tran