Oligodeoxynucleotide Analogues of Circulating DNA Inhibit dsRNA-Induced Immune Response at the Early Stages of Signal Tr
Oligodeoxynucleotide (ODN) analogues of cell-surface-bound circulating DNA inhibit the dsRNA-induced production of pro-inflammatory interleukin 6, interferon beta and antibacterial peptide beta-defensin 2 not only in human gingival fibroblasts, but also i
- PDF / 225,862 Bytes
- 3 Pages / 504.57 x 720 pts Page_size
- 72 Downloads / 232 Views
20
Anna V. Cherepanova, Zhanna K. Nazarkina, and Pavel P. Laktionov
Abstract
Oligodeoxynucleotide (ODN) analogues of cell-surface-bound circulating DNA inhibit the dsRNA-induced production of pro-inflammatory interleukin 6, interferon beta and antibacterial peptide beta-defensin 2 not only in human gingival fibroblasts, but also in human primary endothelial and transformed cells (Hela and A431). ODN analogues do not effect dendritic cells activation by poly(I:C). The data obtained indicate that the early stages of the signal transduction cascade are violated by ODN analogues and the effects depend on the cell type. Keywords
Circulating DNA • Double-stranded RNA • Interleukin • Interferon • Innate immunity
Introduction DNA from different sources including free and cell-surface-bound circulating DNA inhibit the poly(I:C)-activated production of pro-
A.V. Cherepanova (*) • Z.K. Nazarkina P.P. Laktionov Institute of Chemical Biology and Fundamental Medicine SB RAS, Lavrentiev ave., 8, Novosibirsk 630090, Russia e-mail: [email protected]
inflammatory interleukins (IL-6 and IL-8) in human primary gingival fibroblasts, the inhibiting efficacy depending on the DNA sequence (Cherepanova et al. 2013). To identify the mechanisms of the immuno-inhibiting action of DNA, we investigated the influence of specific oligodeoxynucleotide (ODN) analogues on poly(I:C)induced immuno-mediators, produced via signal transduction pathways different to those for IL-6/ IL-8 and in various cell types which may differ in the expression of pattern-recognizing receptors and peculiarities of downstream pathway functioning.
© Springer International Publishing Switzerland 2016 P.B. Gahan et al. (eds.), Circulating Nucleic Acids in Serum and Plasma – CNAPS IX, Advances in Experimental Medicine and Biology 924, DOI 10.1007/978-3-319-42044-8_20
105
106
Materials and Methods Gingival fibroblasts (GF), endothelial cells (HUVEC) and immature dendritic cells (DC) were obtained from human gingiva, umbilical cord vein and blood monocytes, correspondingly (Mailliard et al. 2004; Cherepanova et al. 2013). Primary and transformed cells (cervical carcinoma (HeLa) and human squamous carcinoma (A431)) were incubated with 100 μg/mL poly(I:C) (Sigma) and/or 1 μM ODN 14 (pctgcatgcatttccttctgcattccagctggat). After treatment, these cells and supernatants were collected for gene expression analysis and IL-6 measurement (Vector-Best, Russia), correspondingly (Cherepanova et al. 2013). Oligo(dT)18 primer and M-MuLV Reverse Transcriptase (Fermentas, Lithuania) were used for reverse transcription of total RNA. SYBRGreen Real-time PCR was performed using specific forward (f) and reverse (r) primers (5′ → 3′): IL-6, (f) tctccacaagcgccttcg, (r) ctcagggctgagatgccg; beta-defensin 2 (HBD-2) (f) ctcctcttctcgttcctcttcata, (r) tagggcaaaagactggatgac; interferon beta (hIFN1b) (f) ccaacaagtgtctcctccaaa, (r) gcagtattcaagcctcccatt; GAPDH (f) ttgacggtgccatggaatttg, (r) acggatttggtcgtattgggc. IL-6, HBD-2 and hIFN1b real-time values were nor-
Fig. 20.1 Inhibiting effects of
Data Loading...