A development strategy to fast establish the Taqman qPCR based method to detect SNP mutations
- PDF / 743,410 Bytes
- 3 Pages / 595.276 x 790.866 pts Page_size
- 63 Downloads / 307 Views
LETTER TO THE EDITOR
A development strategy to fast establish the Taqman qPCR based method to detect SNP mutations Xiaohui Jiang1,2 · Junbei Xiang3 · Ruifeng Wang4 · Qian Wan4 Received: 15 April 2020 / Accepted: 6 June 2020 © Japan Human Cell Society 2020
Dear Sir, For the traditional Taqman qPCR based detection method to detect SNP mutations, the general idea is to run multiplex PCR or contain several probe pairs into one reaction tube, which can save material resources but may cost much time and energy [1–3]. The above idea is suitable under the normal conditions. However, it is unsuitable under the emergency conditions such as in the current COVID-19 pandemic, when the time efficiency is vital. This study tried to develop the strategy to fast build the Taqman qPCR based detection method to detect SNP mutations in order that time could be saved or be gained with the cost of relatively ample material resources. The novelty of this study was that by omitting of optimization for multiplex PCR and/or several probe pairs in one reaction tube, the method development time was saved or gained with the cost of relatively abundant material resources. In this study, the investigation process was the following: (1) 1 ml finger blood was collected from the individuals and the genomic DNA was extracted using the extraction kit (DP348, Tiangen Co. Ltd, China); (2) the human SNP site rs4148323 was selected as the experimental object because of the availability of related experimental materials and the * Qian Wan [email protected] 1
Human sperm bank, West China Second University Hospital of Sichuan University, Chengdu 610041, Sichuan, People’s Republic of China
2
Key Laboratory of Birth Defects and Related Diseases of Women and Children (Sichuan University), Ministry of Education, Chengdu 610041, Sichuan, People’s Republic of China
3
Sichuan Nursing Vocational College, Chengdu 610000, Sichuan, People’s Republic of China
4
Chengdu Neo-Life Hope Medical Lab. Co. Ltd, Chengdu 610036, Sichuan, People’s Republic of China
richness of background information. The flanking sequence of rs4148323 was the following (the polymorphic site [G/A] was marked bold): CAGCCACTGGCTGAGCATGCTTGGGGCCATCCA GCAG CTG CAG CAG AGG GGA CAT GAA ATA GTT GTC CT AGCACCTGACGCCTCGTTGTACATCAGAGAC [G/A] GAGCATTTTACACCTTGAAGACGTACCCTGTGC CATT CCA AAG GGA GGA TGT GAA AGA GTC TTT TGT TA GTCTCGGGCATAATGTTTTTGAGAATGATTC (3) the primers and probes were designed with the software Primer Express 3.1 and synthesized by the local merchant (Qingke Co. Ltd). The sequences of the primers and probes are listed in Table 1. For the probes, they were ligated with the fluorescent molecule FAM at 5′ end and the fluorescent quencher molecule TAMRA at 3′ end; (4) Taqman qPCR: The 2 × master mix for Taqman qPCR (SGExcel GoldStar) was purchased from Shanghai Sangon Biotech Co. Ltd. The qPCR instrument was Stepone Plus (ABI Co. Ltd, USA). For every detection, two tubes were prepared: i
Data Loading...