Inhibition of Histone Deacetylase 1 Prevents the Decrease in Titin (Connectin) Content and Development of Atrophy in Rat

  • PDF / 808,827 Bytes
  • 8 Pages / 594 x 792 pts Page_size
  • 84 Downloads / 257 Views

DOWNLOAD

REPORT


450

Bulletin of Experimental Biology and Medicine, Vol. 169, No. 4, August, 2020 BIOPHYSICS AND BIOCHEMISTRY

Inhibition of Histone Deacetylase 1 Prevents the Decrease in Titin (Connectin) Content and Development of Atrophy in Rat m. soleus after 3-Day Hindlimb Unloading A. D. Ulanova1, Yu. V. Gritsyna1, A. G. Bobylev1, E. I. Yakupova1, V. K. Zhalimov2, S. P. Belova3, E. P. Mochalova3, T. L. Nemirovskaya3, B. S. Shenkman3, and I. M. Vikhlyantsev1

Translated from Byulleten’ Eksperimental’noi Biologii i Meditsiny, Vol. 169, No. 4, pp. 431-438, April, 2020 Original article submitted November 1, 2019 We studied the effect of histone deacetylase 1 (HDAC1) inhibition on titin content and expression of TTN gene in rat m. soleus after 3-day gravitational unloading. Male Wistar rats weighing 210±10 g were randomly divided into 3 groups: control, 3-day hindlimb suspension, and 3-day hindlimb suspension and injection of HDAC1 inhibitor CI-994 (1 mg/kg/ day). In hindlimb-suspended rats, the muscle weight/animal body weight ratio was reduced by 13.8% (p2.0, i.e. they were sufficiently pure from carbohydrates, peptides, phenols, or aromatic compounds. For reverse transcription, aqueous solution containing 1 μg total RNA, 30 μM random hexanucleo­ tides, and 17.4 μM of oligo-d(T)15 was incubated for 3 min at 70°C and immediately transferred to ice. Then 11.5 μl of master-mix (1.3 mM dNTP, 0.02 U/μl RNase inhibitor, 6 U/μl M-MLV revertase, 4 μl 5× buffer for M-MLV revertase) was added to mixture (all reagents were from Synthol) Samples were placed in amplifier (iQ5 Multicolor Real-Time PCR Detection System, Bio-Rad Laboratories) for cDNA synthesis: 10 min at 25°C, 60 min at 37°C, 5 min at 95°C, 30 min at 4°C. The obtained cDNA was used for PCR with specific primers for genes of studied proteins (titin and reference gene GAPDH; Table 1). The primers were

452

Bulletin of Experimental Biology and Medicine, Vol. 169, No. 4, August, 2020 BIOPHYSICS AND BIOCHEMISTRY

TABLE 1. Primers for Real-Time PCR Gene TTN

Nucleotide sequence

Product size, bp

F: CAGCAGCCAAGAAAGCCGCT

71

R: CACCACTCTGATACTCTGAGGCTCTG GAPDH

F: GCAAGAGAGAGGCCCTCAG

74

R: TGTGAGGGAGATGCTCAGTG

selected using Vector NTI Advance 11 software. Pri­ mers were synthesized by Eurogen company. Real-time PCR was performed using a DT-322 amplifier (DNATechnology), Taq-DNA polymerase (Eurogen), and SYBR Green I fluorescent dye (Invitrogen). PCR was performed as follows: 1) hot start at 95°C for 5 min, 2) denaturation at 95°C for 15 sec, 3) primer annealing at 64°C for 20 sec, and 4) extension at 72°C for 20 sec. Stages 2-4 were repeated 35 times. The changes in titin gene expression were determined according to the 2—ΔΔСt method. ΔΔСt was calculated by the formula: ΔΔСt=ΔСt(control)-ΔСt (experiment); each ΔСt was calculated by the formula: ΔСt=Сt(protein gene)Сt (reference gene) The amplification products were analyzed by electrophoresis in a 2% agarose gel. The PCR products were isolated from the gel according to the Cleanup Standard protocol (Eurogen). DNA fragments we