A novel primer set for mammal species identification from feces samples
- PDF / 166,793 Bytes
- 3 Pages / 595.276 x 790.866 pts Page_size
- 90 Downloads / 245 Views
TECHNICAL NOTE
A novel primer set for mammal species identification from feces samples Florencia Grattarola • S. Gonza´lez M. Cosse
•
Received: 20 August 2014 / Accepted: 14 October 2014 / Published online: 18 October 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract We described a technique for detecting mammal species, based on the analysis of a control region fragment of mitochondrial DNA by establishing taxonomic identity from non-invasive samples. We detected a polymorphic fragment that varies in sequence and length within different mammalian species but maintains its identity among individuals of the same species. We amplified a single fragment in all the mammalian species tested from tissue samples and identified feces samples at species level. The use of a unique set of primers to assess the presence of different mammal species with non-invasive sampling allowed us to differentiate sequences from more than one species per environmental sample. Thus, it constitutes a powerful molecular tool for inventory and description of the mammal diversity distribution in natural areas. Keywords Noninvasive sampling Species determination Mammalia monitoring Wildlife forensics The combination of noninvasive genetic sampling and novel tools for molecular species identification enables monitoring the geographical occupancy of species (Waits and Paetkau 2005; Schwartz et al. 2007). Feces contain DNA that can be amplified by PCR analysis generating species-specific sequences to unambiguously identify samples (Kohn and Wayne 1997; Taberlet and Gordon F. Grattarola S. Gonza´lez M. Cosse (&) Gene´tica de la Conservacio´n-Departamento de Biodiversidad y Gene´tica, IIBCE- MEC, Av. Italia 3318, 11600 Montevideo, Uruguay e-mail: [email protected] S. Gonza´lez Seccio´n Gene´tica Evolutiva Facultad de Ciencias, UdelaR, Montevideo, Uruguay
1999; Gonza´lez and Duarte 2007). We described a molecular ecology technique for detecting mammal species, based on the analysis of a fragment of the control region (CR) of mitochondrial DNA, establishing taxonomic identity from noninvasive samples, such as feces. Two types of samples were used: tissue, (N = 33) with precise taxonomic identification and feces (N = 34), with taxonomic order level determination. Tissue samples belonged to the Conservation Genetics-IIBCE tissue and DNA Bank, whereas feces were obtained in different surveys in the locality of Centurion, department of Cerro Largo (32° 60 30.5200 S; 53°440 44.3900 W). Muscle and skin DNA was isolated following the Medrano et al. (1990) protocol. DNA extraction from feces was performed with DNeasy kit Mericon Food, following the manufacturer’s protocol. Primers (MAMCODEF 50 ATGGGCCCGGAGCGAGA AGA/MAMCODER 50 AGAATNTCAGCTTTGGGWG) were designed over a 55 GenBank sequences database for both flanking ends of a variable region amplified with primers Thr-L15926 50 CAATTCCCCGGTCTTGTAAA CC/DL-H16340 50 CCTGAAGTAGGAACCAGATG (Vila et al. 1999). For the fecal material, a nested PCR was carried out to increase the efficiency
Data Loading...