Correction to: CXCR5 overexpression in HL-60 cells enhances chemotaxis toward CXCL13 without anticipated interaction par
- PDF / 112,070 Bytes
- 1 Pages / 595.276 x 790.866 pts Page_size
- 86 Downloads / 137 Views
CORRECTION
Correction to: CXCR5 overexpression in HL-60 cells enhances chemotaxis toward CXCL13 without anticipated interaction partners or enhanced MAPK signaling Robert J. MacDonald 1 & Andrew Yen 1
# The Society for In Vitro Biology 2020
Correction to: In Vitro Cellular & Developmental Biology - Animal
https://doi.org/10.1007/s11626-018-0293-z There is a typographical error in the primer sequence published in this article. The correct sequence of the NheI 5′ site primer given in Materials and Methods on p727 is: NheI: 5′TATGGCTAGCATGAACTACCCGCTAACGCTG-3, not NheI: 5′- TATGCCTAGCATGAACTACCCGCTAA CGCTG-3 which has C instead of the correct G. There is no change in the results or conclusions reported in the publication.
The online version of the original article can be found at https://doi.org/ 10.1007/s11626-018-0293-z * Andrew Yen [email protected] 1
Department of Biomedical Sciences, Cornell University College of Veterinary Medicine, Veterinary Research Tower T4008A, Box 11, Ithaca, NY 14853, USA
Data Loading...